Follow TV Tropes

Following

History UsefulNotes / DNA

Go To



In 1958 Crick established what is known as the central dogma of molecular biology (no, not [[Anime/NeonGenesisEvangelion that central dogma]], but that one is named after this), that information flows generally from DNA to RNA to protein, never from protein back to nucleic acid. The Meselson-Stahl experiment of the same year established the semi-conservative method of DNA replication (each parent strand is paired with a daughter strand). Crick et al. discovered DNA coded for proteins in non-overlapping triplets of bases (called codons) each of which coded for only one amino acid (the basic building block of proteins; there are 20 amino acids and 64 codons, and most amino acids are coded for by more than one codon). Further work by Khorana, Holley, and Nirenberg established the correspondence between each codon and amino acid, and molecular genetics was truly a science.

to:

In 1958 Crick established what is known as the central dogma of molecular biology (no, not [[Anime/NeonGenesisEvangelion that central dogma]], but that one is named after this), that information flows generally from DNA to RNA to protein, protein [[note]]Watson later revealed that the reason he chose such an unscientific term as "dogma" to describe his theory because he was confused on what the word meant[[/note]], never from protein back to nucleic acid. The Meselson-Stahl experiment of the same year established the semi-conservative method of DNA replication (each parent strand is paired with a daughter strand). Crick et al. discovered DNA coded for proteins in non-overlapping triplets of bases (called codons) each of which coded for only one amino acid (the basic building block of proteins; there are 20 amino acids and 64 codons, and most amino acids are coded for by more than one codon). Further work by Khorana, Holley, and Nirenberg established the correspondence between each codon and amino acid, and molecular genetics was truly a science.


In 1958 Crick established what is known as the central dogma of molecular biology (no, not [[NeonGenesisEvangelion that central dogma]], but that one is named after this), that information flows generally from DNA to RNA to protein, never from protein back to nucleic acid. The Meselson-Stahl experiment of the same year established the semi-conservative method of DNA replication (each parent strand is paired with a daughter strand). Crick et al. discovered DNA coded for proteins in non-overlapping triplets of bases (called codons) each of which coded for only one amino acid (the basic building block of proteins; there are 20 amino acids and 64 codons, and most amino acids are coded for by more than one codon). Further work by Khorana, Holley, and Nirenberg established the correspondence between each codon and amino acid, and molecular genetics was truly a science.

to:

In 1958 Crick established what is known as the central dogma of molecular biology (no, not [[NeonGenesisEvangelion [[Anime/NeonGenesisEvangelion that central dogma]], but that one is named after this), that information flows generally from DNA to RNA to protein, never from protein back to nucleic acid. The Meselson-Stahl experiment of the same year established the semi-conservative method of DNA replication (each parent strand is paired with a daughter strand). Crick et al. discovered DNA coded for proteins in non-overlapping triplets of bases (called codons) each of which coded for only one amino acid (the basic building block of proteins; there are 20 amino acids and 64 codons, and most amino acids are coded for by more than one codon). Further work by Khorana, Holley, and Nirenberg established the correspondence between each codon and amino acid, and molecular genetics was truly a science.





In 1958 Crick established what is known as the central dogma of molecular biology (no, not [[NeonGenesisEvangelion that central dogma]]), that information flows generally from DNA to RNA to protein, never from protein back to nucleic acid. The Meselson-Stahl experiment of the same year established the semi-conservative method of DNA replication (each parent strand is paired with a daughter strand). Crick et al. discovered DNA coded for proteins in non-overlapping triplets of bases (called codons) each of which coded for only one amino acid (the basic building block of proteins; there are 20 amino acids and 64 codons, and most amino acids are coded for by more than one codon). Further work by Khorana, Holley, and Nirenberg established the correspondence between each codon and amino acid, and molecular genetics was truly a science.

to:

In 1958 Crick established what is known as the central dogma of molecular biology (no, not [[NeonGenesisEvangelion that central dogma]]), dogma]], but that one is named after this), that information flows generally from DNA to RNA to protein, never from protein back to nucleic acid. The Meselson-Stahl experiment of the same year established the semi-conservative method of DNA replication (each parent strand is paired with a daughter strand). Crick et al. discovered DNA coded for proteins in non-overlapping triplets of bases (called codons) each of which coded for only one amino acid (the basic building block of proteins; there are 20 amino acids and 64 codons, and most amino acids are coded for by more than one codon). Further work by Khorana, Holley, and Nirenberg established the correspondence between each codon and amino acid, and molecular genetics was truly a science.


The structure of DNA was elucidated in 1952 by the famous Watson and Crick where they gave the familiar double-helix model based on an X-ray diffraction study by Rosalind Franklin and knowledge from Erwin Chargaff's studies that DNA paired. [[DidNotDoTheResearch Despite what has occasionally been said]], Watson and Crick actually did give thanks to Franklin in their groundbreaking paper, though there is little doubt her work was somewhat diminished for the important role it played and there is [[BrokenBase still debate]] as to who really made the discovery. Interestingly, a structure had previously been postulated by Linus Pauling and Robert Corey which was triple-stranded with the [[ScienceMarchesOn phosphate-sugar backbones on the inside]]. DNA does occasionally form triple-helices, but of a different structure.

to:

The structure of DNA was elucidated in 1952 by the famous Watson and Crick where they gave the familiar double-helix model based on an X-ray diffraction study by Rosalind Franklin and knowledge from Erwin Chargaff's studies that DNA paired. [[DidNotDoTheResearch Despite what has occasionally been said]], said, Watson and Crick actually did give thanks to Franklin in their groundbreaking paper, though there is little doubt her work was somewhat diminished for the important role it played and there is [[BrokenBase still debate]] as to who really made the discovery. Interestingly, a structure had previously been postulated by Linus Pauling and Robert Corey which was triple-stranded with the [[ScienceMarchesOn phosphate-sugar backbones on the inside]]. DNA does occasionally form triple-helices, but of a different structure.


The structure of DNA was elucidated in 1952 by the famous Watson and Crick where they gave the familiar double-helix model based on an X-ray diffraction study by Rosalind Franklin and knowledge from Erwin Chargaff's studies that DNA paired. [[DidNotDoTheResearch Despite what has occasionally been said]], Watson and Crick actually did give thanks to Franklin in their groundbreaking paper, though there is little doubt her work was somewhat diminished for the important role it played and there is [[BrokenBase still debate]] as to who really made the discovery. Interestingly, a structure had previously been postulated by Linus Pauling and Robert Corey which was triple-stranded with the [[YouFailBiologyForever phosphate-sugar backbones on the inside]]. DNA does occasionally form triple-helices, but of a different structure.

to:

The structure of DNA was elucidated in 1952 by the famous Watson and Crick where they gave the familiar double-helix model based on an X-ray diffraction study by Rosalind Franklin and knowledge from Erwin Chargaff's studies that DNA paired. [[DidNotDoTheResearch Despite what has occasionally been said]], Watson and Crick actually did give thanks to Franklin in their groundbreaking paper, though there is little doubt her work was somewhat diminished for the important role it played and there is [[BrokenBase still debate]] as to who really made the discovery. Interestingly, a structure had previously been postulated by Linus Pauling and Robert Corey which was triple-stranded with the [[YouFailBiologyForever [[ScienceMarchesOn phosphate-sugar backbones on the inside]]. DNA does occasionally form triple-helices, but of a different structure.





-> |||||||||||||||||||||||||||||||||||


Added DiffLines:




to:

-> GATACTTACAGTATAGGTATCATCATATCAGCTAG
-> |||||||||||||||||||||||||||||||||||
-> CTATGAATGTCATATCCATAGTAGTATAGTCGATC


The Stuff of Life. Or, to be more precise, the Stuff of Inheritance and Instruction. DNA acts as an information carrier which is passed on from a parent organism to its descendants, and which provides the instructions for the protein-production systems in cells to make, well, proteins, which may then make or process other biomolecules, enabling the continuance of a cell.

to:

[[quoteright:320:http://static.tvtropes.org/pmwiki/pub/images/double_helix_7722.jpg]]

Deoxyribonucleic acid.
The Stuff of Life. Or, to be more precise, the Stuff of Inheritance and Instruction. DNA acts as an information carrier which is passed on from a parent organism to its descendants, and which provides the instructions for the protein-production systems in cells to make, well, proteins, which may then make or process other biomolecules, enabling the continuance of a cell.

Showing 8 edit(s) of 8

Top

How well does it match the trope?

Example of:

/

Media sources:

/

Report